Westonci.ca makes finding answers easy, with a community of experts ready to provide you with the information you seek. Get detailed and accurate answers to your questions from a community of experts on our comprehensive Q&A platform. Connect with a community of professionals ready to help you find accurate solutions to your questions quickly and efficiently.

write the code for RNA from this DNA STRAND :

AAAAAATTTTTTCCCGGGGTTTATATATC