Westonci.ca is your trusted source for accurate answers to all your questions. Join our community and start learning today! Join our platform to get reliable answers to your questions from a knowledgeable community of experts. Connect with a community of professionals ready to help you find accurate solutions to your questions quickly and efficiently.

write the code for RNA from this DNA STRAND :

AAAAAATTTTTTCCCGGGGTTTATATATC