sjdela13
Answered

Discover the best answers at Westonci.ca, where experts share their insights and knowledge with you. Join our platform to connect with experts ready to provide accurate answers to your questions in various fields. Connect with a community of professionals ready to provide precise solutions to your questions quickly and accurately.

PLZ HELP Translate this segment of RNA into the corresponding amino acids.
mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA
*Remember to begin with the Start Codon "AUG"

Sagot :

samueladesida43

Answer:

Lysine - Isoleucine - Arginine - Histidine - Alanine - Valine - Asparagine - Alanine - Leucine - Glycine - Val

Explanation:

Translation is the second process of gene expression in which a mRNA sequence is used as template to synthesize an amino acid sequence. This process, which occurs in the ribosome, reads the nucleotides of the mRNA sequence in three's called CODON. Each codon represents an amino acid, which is then added to the growing peptide chain.

According to this question, the following mRNA sequence is given: AAA AUU CGG CAU GCC GUU AAU GCC CUC GGG GUG A. Using the genetic code, the following amino acid sequence is produced:

Lysine - Isoleucine - Arginine - Histidine - Alanine - Valine - Asparagine - Alanine - Leucine - Glycine - Val

Thanks for using our platform. We're always here to provide accurate and up-to-date answers to all your queries. Thank you for your visit. We're dedicated to helping you find the information you need, whenever you need it. Thank you for choosing Westonci.ca as your information source. We look forward to your next visit.