sjdela13
Answered

Get the answers you need at Westonci.ca, where our expert community is always ready to help with accurate information. Discover precise answers to your questions from a wide range of experts on our user-friendly Q&A platform. Connect with a community of professionals ready to provide precise solutions to your questions quickly and accurately.

PLZ HELP Translate this segment of RNA into the corresponding amino acids.
mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA
*Remember to begin with the Start Codon "AUG"

Sagot :

samueladesida43

Answer:

Lysine - Isoleucine - Arginine - Histidine - Alanine - Valine - Asparagine - Alanine - Leucine - Glycine - Val

Explanation:

Translation is the second process of gene expression in which a mRNA sequence is used as template to synthesize an amino acid sequence. This process, which occurs in the ribosome, reads the nucleotides of the mRNA sequence in three's called CODON. Each codon represents an amino acid, which is then added to the growing peptide chain.

According to this question, the following mRNA sequence is given: AAA AUU CGG CAU GCC GUU AAU GCC CUC GGG GUG A. Using the genetic code, the following amino acid sequence is produced:

Lysine - Isoleucine - Arginine - Histidine - Alanine - Valine - Asparagine - Alanine - Leucine - Glycine - Val

We hope our answers were helpful. Return anytime for more information and answers to any other questions you may have. Thank you for your visit. We're dedicated to helping you find the information you need, whenever you need it. Stay curious and keep coming back to Westonci.ca for answers to all your burning questions.