Answered

Welcome to Westonci.ca, the ultimate question and answer platform. Get expert answers to your questions quickly and accurately. Experience the convenience of getting accurate answers to your questions from a dedicated community of professionals. Discover detailed answers to your questions from a wide network of experts on our comprehensive Q&A platform.

The mRNA generated below was produced in the
of the cell.
5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

Sagot :

Histrionicus

The mRNA generated below was produced in the  nucleus of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

https://brainly.com/question/11430054

We appreciate your time. Please revisit us for more reliable answers to any questions you may have. We appreciate your time. Please come back anytime for the latest information and answers to your questions. Get the answers you need at Westonci.ca. Stay informed with our latest expert advice.