Share £65 in the ratio 3:2

Question

03-10-2021
Mathematics

Answered

Discover the answers to your questions at Westonci.ca, where experts share their knowledge and insights with you. Explore thousands of questions and answers from knowledgeable experts in various fields on our Q&A platform. Get detailed and accurate answers to your questions from a dedicated community of experts on our Q&A platform.

Share £65 in the ratio 3:2

Sagot :

Thank you for your visit. We're committed to providing you with the best information available. Return anytime for more. We appreciate your visit. Our platform is always here to offer accurate and reliable answers. Return anytime. Thank you for trusting Westonci.ca. Don't forget to revisit us for more accurate and insightful answers.

Given the functions [tex]\( f \)[/tex] and [tex]\( g \)[/tex] below, find [tex]\( g(f(0)) \)[/tex].[tex]\( f(x) = 4x + 1 \)[/tex][tex]\( g(x) = 5x - 3 \)[/tex]

Which of the following sentences is punctuated correctly?A. The deepest, place in the ocean is about 7, miles down the Mariana trench in the Pacific OceanB. The

What are four marketing mix (4ps) strategy for fast food hungry jacks and explain wit example ?

Here is the published sequence for the portion of the PTC gene that you will amplify today.5’- CCTTCGTTTTCTTGGTGAATTTTTGGGATGTAGTGAAGAGGCGGCCACTGAGCAACAGTGATTGT

Can someone check my work? Question Drag and drop into the boxes the direct and indirect object pronouns that correctly complete the sentence. Los estudiantes

How does Simultaneous Multithreading enable the concurrent execution of multiple instructions from independent threads?

After a rotation, [tex][tex]\( A(-3,4) \)[/tex][/tex] maps to [tex][tex]\( A^{\prime}(4,3) \)[/tex][/tex], [tex][tex]\( B(4,-5) \)[/tex][/tex] maps to [tex][tex

Match the ideas with the correct Enlightenment philosopher:1. Separation of powers2. Belief in democracy3. Freedom of religion4. Checks and balances5. Separatio

Complete the table of values for [tex]\( y = x^2 - x \)[/tex].[tex]\[ \begin{array}{|c|c|c|c|c|c|c|c|} \hline x & -3 & -2 & -1 & 0 & 1 &

Find an equivalent ratio where the game-play time is 72 minutes. Complete the table.| Game-Play Time (min) | Total Practice Time (min) ||----------------------|