Answered

Looking for answers? Westonci.ca is your go-to Q&A platform, offering quick, trustworthy responses from a community of experts. Discover reliable solutions to your questions from a wide network of experts on our comprehensive Q&A platform. Connect with a community of professionals ready to help you find accurate solutions to your questions quickly and efficiently.

Which mrna sequences would form a structure that is a cue for transcription termination of some genes?

Sagot :

mhernandez92182

Answer:

First, you must know what the stop codons are: UAA, UAG, and UGA

Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed

Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"

Explanation:

shivjimishraVT

Those mRNA sequences that consist of the stop codons like UAA, UGA, and UAG would form a structure that is a cue for transcription termination of some genes.

What do you mean by Transcription?

Transcription may be defined as the process by which the information in a strand of DNA is copied into a new molecule of messenger RNA (mRNA).

Stop codons are responsible for the termination of transcription of almost all the genes. They are necessary for inhibiting the excessive expression of some genes.

Therefore, those mRNA sequences that consist of the stop codons like UAA, UGA, and UAG would form a structure that is a cue for transcription termination of some genes.

To learn more about Transcription, refer to the link:

https://brainly.com/question/1048150

#SPJ4

Thank you for visiting our platform. We hope you found the answers you were looking for. Come back anytime you need more information. We hope this was helpful. Please come back whenever you need more information or answers to your queries. Get the answers you need at Westonci.ca. Stay informed with our latest expert advice.