Answered

Discover a world of knowledge at Westonci.ca, where experts and enthusiasts come together to answer your questions. Ask your questions and receive detailed answers from professionals with extensive experience in various fields. Join our platform to connect with experts ready to provide precise answers to your questions in different areas.

Which mrna sequences would form a structure that is a cue for transcription termination of some genes?

Sagot :

mhernandez92182

Answer:

First, you must know what the stop codons are: UAA, UAG, and UGA

Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed

Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"

Explanation:

shivjimishraVT

Those mRNA sequences that consist of the stop codons like UAA, UGA, and UAG would form a structure that is a cue for transcription termination of some genes.

What do you mean by Transcription?

Transcription may be defined as the process by which the information in a strand of DNA is copied into a new molecule of messenger RNA (mRNA).

Stop codons are responsible for the termination of transcription of almost all the genes. They are necessary for inhibiting the excessive expression of some genes.

Therefore, those mRNA sequences that consist of the stop codons like UAA, UGA, and UAG would form a structure that is a cue for transcription termination of some genes.

To learn more about Transcription, refer to the link:

https://brainly.com/question/1048150

#SPJ4

Thank you for your visit. We are dedicated to helping you find the information you need, whenever you need it. We appreciate your time. Please revisit us for more reliable answers to any questions you may have. We're here to help at Westonci.ca. Keep visiting for the best answers to your questions.