Answered

At Westonci.ca, we connect you with the best answers from a community of experienced and knowledgeable individuals. Connect with a community of experts ready to help you find accurate solutions to your questions quickly and efficiently. Connect with a community of professionals ready to provide precise solutions to your questions quickly and accurately.

Which mrna sequences would form a structure that is a cue for transcription termination of some genes?

Sagot :

mhernandez92182

Answer:

First, you must know what the stop codons are: UAA, UAG, and UGA

Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed

Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"

Explanation:

shivjimishraVT

Those mRNA sequences that consist of the stop codons like UAA, UGA, and UAG would form a structure that is a cue for transcription termination of some genes.

What do you mean by Transcription?

Transcription may be defined as the process by which the information in a strand of DNA is copied into a new molecule of messenger RNA (mRNA).

Stop codons are responsible for the termination of transcription of almost all the genes. They are necessary for inhibiting the excessive expression of some genes.

Therefore, those mRNA sequences that consist of the stop codons like UAA, UGA, and UAG would form a structure that is a cue for transcription termination of some genes.

To learn more about Transcription, refer to the link:

https://brainly.com/question/1048150

#SPJ4

Thanks for using our platform. We're always here to provide accurate and up-to-date answers to all your queries. We appreciate your visit. Our platform is always here to offer accurate and reliable answers. Return anytime. Westonci.ca is your go-to source for reliable answers. Return soon for more expert insights.