Answered

Discover answers to your most pressing questions at Westonci.ca, the ultimate Q&A platform that connects you with expert solutions. Get detailed answers to your questions from a community of experts dedicated to providing accurate information. Get detailed and accurate answers to your questions from a dedicated community of experts on our Q&A platform.

T A C G T G G A C T G A G G A C T C C T C is this a 'sense' strand or 'antisense' strand?

Sagot :

luisvaschetto

The information provided is NOT sufficient to indicate if the TACGTGGACTGAGGACTCCTC sequence is a 'sense' strand or 'antisense' strand.

What is a sense DNA strand?

DNA is a double helix molecule composed of two long chains of nucleotides linked by hydrogen bonds.

During transcription, the sense DNA strand is actively used as template to produce a complementary RNA molecule.

In consequence, it is required to know the sequence of the resulting RNA to determine if the sequence above belongs to a 'sense' strand or 'antisense' strand.

Learn more about transcription here:

https://brainly.com/question/1048150

Thanks for using our service. We're always here to provide accurate and up-to-date answers to all your queries. Thanks for using our platform. We aim to provide accurate and up-to-date answers to all your queries. Come back soon. Get the answers you need at Westonci.ca. Stay informed with our latest expert advice.