Answered

Westonci.ca is the premier destination for reliable answers to your questions, provided by a community of experts. Get quick and reliable answers to your questions from a dedicated community of professionals on our platform. Experience the convenience of finding accurate answers to your questions from knowledgeable experts on our platform.

T A C G T G G A C T G A G G A C T C C T C is this a 'sense' strand or 'antisense' strand?

Sagot :

luisvaschetto

The information provided is NOT sufficient to indicate if the TACGTGGACTGAGGACTCCTC sequence is a 'sense' strand or 'antisense' strand.

What is a sense DNA strand?

DNA is a double helix molecule composed of two long chains of nucleotides linked by hydrogen bonds.

During transcription, the sense DNA strand is actively used as template to produce a complementary RNA molecule.

In consequence, it is required to know the sequence of the resulting RNA to determine if the sequence above belongs to a 'sense' strand or 'antisense' strand.

Learn more about transcription here:

https://brainly.com/question/1048150

Thanks for using our platform. We aim to provide accurate and up-to-date answers to all your queries. Come back soon. Thank you for choosing our platform. We're dedicated to providing the best answers for all your questions. Visit us again. Thank you for trusting Westonci.ca. Don't forget to revisit us for more accurate and insightful answers.