Answered

Discover a world of knowledge at Westonci.ca, where experts and enthusiasts come together to answer your questions. Get detailed and precise answers to your questions from a dedicated community of experts on our Q&A platform. Join our Q&A platform to connect with experts dedicated to providing accurate answers to your questions in various fields.

T A C G T G G A C T G A G G A C T C C T C is this a 'sense' strand or 'antisense' strand?

Sagot :

luisvaschetto

The information provided is NOT sufficient to indicate if the TACGTGGACTGAGGACTCCTC sequence is a 'sense' strand or 'antisense' strand.

What is a sense DNA strand?

DNA is a double helix molecule composed of two long chains of nucleotides linked by hydrogen bonds.

During transcription, the sense DNA strand is actively used as template to produce a complementary RNA molecule.

In consequence, it is required to know the sequence of the resulting RNA to determine if the sequence above belongs to a 'sense' strand or 'antisense' strand.

Learn more about transcription here:

https://brainly.com/question/1048150

Visit us again for up-to-date and reliable answers. We're always ready to assist you with your informational needs. Thanks for using our service. We're always here to provide accurate and up-to-date answers to all your queries. We're glad you visited Westonci.ca. Return anytime for updated answers from our knowledgeable team.