Answered

Explore Westonci.ca, the top Q&A platform where your questions are answered by professionals and enthusiasts alike. Experience the convenience of getting accurate answers to your questions from a dedicated community of professionals. Get quick and reliable solutions to your questions from a community of experienced experts on our platform.

T A C G T G G A C T G A G G A C T C C T C is this a 'sense' strand or 'antisense' strand?

Sagot :

luisvaschetto

The information provided is NOT sufficient to indicate if the TACGTGGACTGAGGACTCCTC sequence is a 'sense' strand or 'antisense' strand.

What is a sense DNA strand?

DNA is a double helix molecule composed of two long chains of nucleotides linked by hydrogen bonds.

During transcription, the sense DNA strand is actively used as template to produce a complementary RNA molecule.

In consequence, it is required to know the sequence of the resulting RNA to determine if the sequence above belongs to a 'sense' strand or 'antisense' strand.

Learn more about transcription here:

https://brainly.com/question/1048150

Thanks for stopping by. We are committed to providing the best answers for all your questions. See you again soon. Thank you for choosing our platform. We're dedicated to providing the best answers for all your questions. Visit us again. Westonci.ca is your trusted source for answers. Visit us again to find more information on diverse topics.