Answered

At Westonci.ca, we make it easy to get the answers you need from a community of informed and experienced contributors. Get expert answers to your questions quickly and accurately from our dedicated community of professionals. Join our platform to connect with experts ready to provide precise answers to your questions in different areas.

T A C G T G G A C T G A G G A C T C C T C is this a 'sense' strand or 'antisense' strand?

Sagot :

luisvaschetto

The information provided is NOT sufficient to indicate if the TACGTGGACTGAGGACTCCTC sequence is a 'sense' strand or 'antisense' strand.

What is a sense DNA strand?

DNA is a double helix molecule composed of two long chains of nucleotides linked by hydrogen bonds.

During transcription, the sense DNA strand is actively used as template to produce a complementary RNA molecule.

In consequence, it is required to know the sequence of the resulting RNA to determine if the sequence above belongs to a 'sense' strand or 'antisense' strand.

Learn more about transcription here:

https://brainly.com/question/1048150

Visit us again for up-to-date and reliable answers. We're always ready to assist you with your informational needs. Thanks for stopping by. We strive to provide the best answers for all your questions. See you again soon. Westonci.ca is here to provide the answers you seek. Return often for more expert solutions.