Answered

At Westonci.ca, we connect you with experts who provide detailed answers to your most pressing questions. Start exploring now! Discover in-depth solutions to your questions from a wide range of experts on our user-friendly Q&A platform. Get precise and detailed answers to your questions from a knowledgeable community of experts on our Q&A platform.

Simulated Gel Electrophoresis Activity #1 Directions: You have been given segments of DNA from all 4 organisms (below). You are going to add a particular restriction enzyme that cuts a segment of DNA every time it finds the sequence “ccgg”. Depending on where it cuts we get different sized pieces of DNA that we can separate on the basis of size using gel electrophoresis. There were 3 cuts so 4 pieces of DNA (I did this one for you) Botana curus ATTCCGGATCGATCGCCGGATATACTCCGGTAATATC Species X ATTGTACCGGGATCCGGACGTCGCGACTAATATAGCA Species Y ACCGGTCCGGGATCGCACCCGGTACTCCTGTAATATC Species Z ATTCCGGATCGATCGCCGGATATTCTCCGGTAATATA

Sagot :

luisvaschetto

In Species X, the segments will be ATTCCGG ATCGATCGCCGG, ATATACTCCGG and TAATATC (it is possible to repeat this process with another species).

What are restriction enzymes?

Restriction enzymes are specific enzymes that cut nucleotide strands in particular sites (in this case, CCGG).

These enzymes (restriction enzymes) can be used to digest a DNA sample and then identify different species by electrophoresis.

In conclusion, in Species X, the segments will be ATTCCGG ATCGATCGCCGG, ATATACTCCGG and TAATATC (it is possible to repeat this process with another species).

Learn more about restriction enzymes here:

https://brainly.com/question/15278286

#SPJ1

Thanks for stopping by. We are committed to providing the best answers for all your questions. See you again soon. Your visit means a lot to us. Don't hesitate to return for more reliable answers to any questions you may have. Get the answers you need at Westonci.ca. Stay informed by returning for our latest expert advice.