Answered

Westonci.ca is the trusted Q&A platform where you can get reliable answers from a community of knowledgeable contributors. Explore thousands of questions and answers from knowledgeable experts in various fields on our Q&A platform. Connect with a community of professionals ready to help you find accurate solutions to your questions quickly and efficiently.

A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write the mRNA that would be transcribed from this DNA fragment.b) Circle the starter and the stopper in your mRNA sequence. Write the sequence of amino acids which would be encoded in translation. Use the mRNA codon table provided.c) Where in the cell do transcription and translation occur?

A Segment Of DNA Is Known To Contain The Following Base Sequence3 GATACCTTTGTGTAGTCATCTT 5a Write The MRNA That Would Be Transcribed From This DNA Fragmentb Cir class=

Sagot :

a) In order to transcribe the segment of DNA, it is important to note that this process is important for gene expression as a protein. An enzyme called RNA polymerase moves along the DNA until the end of the gene, releasing the mRNA. The DNA has two strands: one that goes from 5' to 3' direction, and another one that goes from 3' to 5' direction. The one that's used for transcription will always be the 3' to 5' one, so we already have the correct strand to work with, as it is a 3' to 5' strand.

However, the mRNA will be assembled in the 5' to 3' direction. Using the same complementary base-pairing rules as in DNA, we will pair Cytosine (C) with Guanine (G), but as there is no Thymine (T) in RNA, we will pair Adenine (A) with Uracil (U).

Therefore, the sequence o mRNA read in the 5' to 3' direction is:

5' CUAUGGAAACACAUCAGUAGAA 3'

b) The starter codon is the AUG codon of a messenger RNA (mRNA). Therefore, the sequence of amino acids will start to be decoded there.

The stopper codon can be one of the three following options: UAA, UAG or UGA. In this case, we can only find the UAG codon.

The codons, then will be:

AUG GAA ACA CAU CAG UAG

Then, we can say that the amino acids translated will be:

Met Glu Thr His Gln

(Methionine - Glutamine - Threonine - Histidine - Glutamine

c) In eukaryotes, transcription occurs inside the nucleus of the cell and translation occurs in the cytoplasm.

Thank you for your visit. We're committed to providing you with the best information available. Return anytime for more. We appreciate your visit. Our platform is always here to offer accurate and reliable answers. Return anytime. Westonci.ca is your trusted source for answers. Visit us again to find more information on diverse topics.