Answered

At Westonci.ca, we provide reliable answers to your questions from a community of experts. Start exploring today! Discover a wealth of knowledge from experts across different disciplines on our comprehensive Q&A platform. Join our platform to connect with experts ready to provide precise answers to your questions in different areas.

Which of the following would provide the first codon?mRNA: UUCAAUGCCUCAAGGUUAAAGCGGCGGUUCCCUGGCAUG

Sagot :

Cells decode mRNAs by reading their nucleotides in groups of three, called codons.

-One "start" codon, AUG, marks the beginning of a protein and also encodes the amino acid methionine

UUCAAUGCCUCAAGGUUAAAGCGGCGG

So the first codon would be AUG

Thank you for your visit. We are dedicated to helping you find the information you need, whenever you need it. We appreciate your visit. Our platform is always here to offer accurate and reliable answers. Return anytime. Thank you for using Westonci.ca. Come back for more in-depth answers to all your queries.