At Westonci.ca, we connect you with the best answers from a community of experienced and knowledgeable individuals. Experience the convenience of finding accurate answers to your questions from knowledgeable professionals on our platform. Connect with a community of professionals ready to help you find accurate solutions to your questions quickly and efficiently.

what is the transcribed product of the following non-template strand of dna (acatggagctcttaagatgat)? assume 5-3 orientation.