Answered

Explore Westonci.ca, the leading Q&A site where experts provide accurate and helpful answers to all your questions. Get expert answers to your questions quickly and accurately from our dedicated community of professionals. Explore comprehensive solutions to your questions from a wide range of professionals on our user-friendly platform.

The DNA sequence shown below comes from part of the TP53 gene. It encodes the last amino acids of the p53 protein, which is normally 393 amino acids long. The underlined codon indicates the correct reading frame of this gene. The lower strand of the gene is used as the template during the transcription of mRNA from this gene. The 5 'T on the top strand indicates nucleotide position one.
. . TTCAAGACAGAAGGGCCTGACTCAGACTGACATTCTCC-3'
. . . AAGTTCTGTCTTCCCGGACTGAGTCTGACTGTAAGAGG 5
A mutation that changes the nucleotide at position 25 from to T results in which of the following:
. . TTCAAGACAGAAGGGCCTGACTCAGACTGACATTCTCC-3'

Sagot :

We hope you found this helpful. Feel free to come back anytime for more accurate answers and updated information. Thanks for stopping by. We strive to provide the best answers for all your questions. See you again soon. Westonci.ca is committed to providing accurate answers. Come back soon for more trustworthy information.