The DNA sequence shown below comes from part of the TP53 gene. It encodes the last amino acids of the p53 protein, which is normally 393 amino acids long. The underlined codon indicates the correct reading frame of this gene. The lower strand of the gene is used as the template during the transcription of mRNA from this gene. The 5 'T on the top strand indicates nucleotide position one
. . TTCAAGACAGAAGGGCCTGACTCAGACTGACATTCTCC-3'
. . . AAGTTCTGTCTTCCCGGACTGAGTCTGACTGTAAGAGG 5
A mutation that changes the nucleotide at position 25 from to T results in which of the following:
. . TTCAAGACAGAAGGGCCTGACTCAGACTGACATTCTCC-3'

Question

02-06-2024
Biology

Answered

Westonci.ca offers quick and accurate answers to your questions. Join our community and get the insights you need today. Get immediate answers to your questions from a wide network of experienced professionals on our Q&A platform. Get immediate and reliable solutions to your questions from a community of experienced professionals on our platform.

The DNA sequence shown below comes from part of the TP53 gene. It encodes the last amino acids of the p53 protein, which is normally 393 amino acids long. The underlined codon indicates the correct reading frame of this gene. The lower strand of the gene is used as the template during the transcription of mRNA from this gene. The 5 'T on the top strand indicates nucleotide position one
. . TTCAAGACAGAAGGGCCTGACTCAGACTGACATTCTCC-3'
. . . AAGTTCTGTCTTCCCGGACTGAGTCTGACTGTAAGAGG 5
A mutation that changes the nucleotide at position 25 from to T results in which of the following:
. . TTCAAGACAGAAGGGCCTGACTCAGACTGACATTCTCC-3'

Sagot :

We appreciate your visit. Our platform is always here to offer accurate and reliable answers. Return anytime. We hope this was helpful. Please come back whenever you need more information or answers to your queries. We're here to help at Westonci.ca. Keep visiting for the best answers to your questions.

In a previous unit, you learned that two lines of Hebrew poetry can follow either a synonymous, synthetic, antithetical, emblematic, or climactic form of parall

PLEASE HELP ME ASAP A radio station has a broadcast area in the shape of a circle with equation x2+ y2=5,625, where the constant represents square miles. a. Fin

At many times in history, women were diagnosed or declared mentally incompetent or insane for speaking out or even pursuing education. Which sociological perspe

Write the expression. Then, check all that apply. twice the difference of a number and six A 2-column table with 4 rows. Column 1 is labeled Key Words with entr

Devin volunteers at Big Pup Rescue. He is mixing up shampoo solution for the dog washing station. He needs 2 cups of shampoo concentrate for every 9 cups of wat

Why should the items listed in a will be described as clearly as possible? A. To ensure that worthless assets are thrown away B. To ensure that assets are divid

How did the work progress administration affect employment for young people? they gave younger workers more rights by encouraging union membership. they increas

What’s wrong with this bibliography entry? Harriet Tubman: Secret Agent by Allen, Thomas B. Washington, DC: National Geographic Books, 2006. The year the book w

Sebastian had a rectangular piece of paper that was 90 mm and 50 mm wide. He cut the paper in half, what is the area of one half of the paper?

Sportly, Inc. completed Job No. B14 during 2011. The job cost sheet listed the following: Direct materials $44,000 Direct labor $24,000 Manufacturing overhead a

Sagot :

Other Questions