Answered

Westonci.ca is the best place to get answers to your questions, provided by a community of experienced and knowledgeable experts. Join our Q&A platform to connect with experts dedicated to providing accurate answers to your questions in various fields. Get quick and reliable solutions to your questions from a community of experienced experts on our platform.

The DNA sequence shown below comes from part of the TP53 gene. It encodes the last amino acids of the p53 protein, which is normally 393 amino acids long. The underlined codon indicates the correct reading frame of this gene. The lower strand of the gene is used as the template during the transcription of mRNA from this gene. The 5 'T on the top strand indicates nucleotide position one
. . TTCAAGACAGAAGGGCCTGACTCAGACTGACATTCTCC-3'
. . . AAGTTCTGTCTTCCCGGACTGAGTCTGACTGTAAGAGG 5
A mutation that changes the nucleotide at position 25 from to T results in which of the following:
. . TTCAAGACAGAAGGGCCTGACTCAGACTGACATTCTCC-3'

Sagot :

We appreciate your time on our site. Don't hesitate to return whenever you have more questions or need further clarification. Thanks for using our platform. We aim to provide accurate and up-to-date answers to all your queries. Come back soon. Thank you for choosing Westonci.ca as your information source. We look forward to your next visit.