Answered

Looking for answers? Westonci.ca is your go-to Q&A platform, offering quick, trustworthy responses from a community of experts. Join our platform to connect with experts ready to provide detailed answers to your questions in various areas. Connect with a community of professionals ready to provide precise solutions to your questions quickly and accurately.

The DNA sequence shown below comes from part of the TP53 gene. It encodes the last amino acids of the p53 protein, which is normally 393 amino acids long. The underlined codon indicates the correct reading frame of this gene. The lower strand of the gene is used as the template during the transcription of mRNA from this gene. The 5 'T on the top strand indicates nucleotide position one
. . TTCAAGACAGAAGGGCCTGACTCAGACTGACATTCTCC-3'
. . . AAGTTCTGTCTTCCCGGACTGAGTCTGACTGTAAGAGG 5
A mutation that changes the nucleotide at position 25 from to T results in which of the following:
. . TTCAAGACAGAAGGGCCTGACTCAGACTGACATTCTCC-3'

Sagot :

Thanks for stopping by. We are committed to providing the best answers for all your questions. See you again soon. We hope this was helpful. Please come back whenever you need more information or answers to your queries. Discover more at Westonci.ca. Return for the latest expert answers and updates on various topics.