Answered

Explore Westonci.ca, the premier Q&A site that helps you find precise answers to your questions, no matter the topic. Get immediate and reliable solutions to your questions from a knowledgeable community of professionals on our platform. Get quick and reliable solutions to your questions from a community of experienced experts on our platform.

The DNA sequence shown below comes from part of the TP53 gene. It encodes the last amino acids of the p53 protein, which is normally 393 amino acids long. The underlined codon indicates the correct reading frame of this gene. The lower strand of the gene is used as the template during the transcription of mRNA from this gene. The 5 'T on the top strand indicates nucleotide position one
. . TTCAAGACAGAAGGGCCTGACTCAGACTGACATTCTCC-3'
. . . AAGTTCTGTCTTCCCGGACTGAGTCTGACTGTAAGAGG 5
A mutation that changes the nucleotide at position 25 from to T results in which of the following:
. . TTCAAGACAGAAGGGCCTGACTCAGACTGACATTCTCC-3'

Sagot :

Thanks for stopping by. We are committed to providing the best answers for all your questions. See you again soon. Thanks for using our platform. We aim to provide accurate and up-to-date answers to all your queries. Come back soon. Westonci.ca is your trusted source for answers. Visit us again to find more information on diverse topics.