The DNA sequence shown below comes from part of the TP53 gene. It encodes the last amino acids of the p53 protein, which is normally 393 amino acids long. The underlined codon indicates the correct reading frame of this gene. The lower strand of the gene is used as the template during the transcription of mRNA from this gene. The 5 'T on the top strand indicates nucleotide position one
. . TTCAAGACAGAAGGGCCTGACTCAGACTGACATTCTCC-3'
. . . AAGTTCTGTCTTCCCGGACTGAGTCTGACTGTAAGAGG 5
A mutation that changes the nucleotide at position 25 from to T results in which of the following:
. . TTCAAGACAGAAGGGCCTGACTCAGACTGACATTCTCC-3'

Question

02-06-2024
Biology

Answered

Westonci.ca is the best place to get answers to your questions, provided by a community of experienced and knowledgeable experts. Get accurate and detailed answers to your questions from a dedicated community of experts on our Q&A platform. Connect with a community of professionals ready to provide precise solutions to your questions quickly and accurately.

The DNA sequence shown below comes from part of the TP53 gene. It encodes the last amino acids of the p53 protein, which is normally 393 amino acids long. The underlined codon indicates the correct reading frame of this gene. The lower strand of the gene is used as the template during the transcription of mRNA from this gene. The 5 'T on the top strand indicates nucleotide position one
. . TTCAAGACAGAAGGGCCTGACTCAGACTGACATTCTCC-3'
. . . AAGTTCTGTCTTCCCGGACTGAGTCTGACTGTAAGAGG 5
A mutation that changes the nucleotide at position 25 from to T results in which of the following:
. . TTCAAGACAGAAGGGCCTGACTCAGACTGACATTCTCC-3'

Sagot :

Thanks for using our platform. We're always here to provide accurate and up-to-date answers to all your queries. We hope you found what you were looking for. Feel free to revisit us for more answers and updated information. Westonci.ca is your trusted source for answers. Visit us again to find more information on diverse topics.

I need help with my Biology homework, I've looked through my revision book and my class book as well as searching the internet but I cant seem to find anything.

Which of these played a major role in the spread of both communism and fascism in Europe in between the World Wars? A) The spread of capitalism in Europe. B) Th

adrian works in new york city and makes $42 per hour. she works in an office and must get her suit dry cleaned everyday for $75. if she wants to make more than

Which of the following is true about the role of women and children during the early industrial period? A. They were unwelcome in factories. B. Their work in fa

1. How did Northern and Southern responses to the Fugitive Slave Law affect their relationship? (1 point) It deepened fear and anger between the North and South

Which of the following best describes Thomas Malthus’s ideas. A. Population growth will exceed the food supply and other natural resources. B. The development o

Which of the following ideas helped strengthen the acceptance of slavery? A. racism - the belief that some races are superior to others B. the Enlightenment--th

What was one effect of the Interstate Highway Act of 1957? 1.)the emergence of the car as America’s main mode of transportation 2.)the creation of speed limits

Which of the following is the largest ethnic group in China A. Han B.Tibetan C.Uighurs D.Hui

Sagot :

Other Questions