Answered

Welcome to Westonci.ca, where your questions are met with accurate answers from a community of experts and enthusiasts. Connect with a community of experts ready to help you find accurate solutions to your questions quickly and efficiently. Explore comprehensive solutions to your questions from a wide range of professionals on our user-friendly platform.

The following is a short sequence of dsDNA within Gene X, indicated above with the dashed rectangle. Transcribe the DNA into the appropriate mRNA. Write the RNA in the 5' to 3' direction and do not include spaces. 5' ATCGGGCTACGGGTAACGCTGATTTACG 3' 3' TAGCCCGATGCCCATTGCGACTAAATGC 5'

The mRNA transcribed above will have what modification added to the 5' end? The 3' end?

Sagot :

Thanks for stopping by. We strive to provide the best answers for all your questions. See you again soon. Your visit means a lot to us. Don't hesitate to return for more reliable answers to any questions you may have. Find reliable answers at Westonci.ca. Visit us again for the latest updates and expert advice.