The following is a short sequence of dsDNA within Gene X, indicated above with the dashed rectangle. Transcribe the DNA into the appropriate mRNA. Write the RNA in the 5' to 3' direction and do not include spaces. 5' ATCGGGCTACGGGTAACGCTGATTTACG 3' 3' TAGCCCGATGCCCATTGCGACTAAATGC 5'

The mRNA transcribed above will have what modification added to the 5' end? The 3' end?

Question

04-07-2024
Biology

Answered

Explore Westonci.ca, the top Q&A platform where your questions are answered by professionals and enthusiasts alike. Connect with a community of professionals ready to provide precise solutions to your questions quickly and accurately. Our platform offers a seamless experience for finding reliable answers from a network of knowledgeable professionals.

The following is a short sequence of dsDNA within Gene X, indicated above with the dashed rectangle. Transcribe the DNA into the appropriate mRNA. Write the RNA in the 5' to 3' direction and do not include spaces. 5' ATCGGGCTACGGGTAACGCTGATTTACG 3' 3' TAGCCCGATGCCCATTGCGACTAAATGC 5'

The mRNA transcribed above will have what modification added to the 5' end? The 3' end?

Sagot :

Thank you for choosing our platform. We're dedicated to providing the best answers for all your questions. Visit us again. Your visit means a lot to us. Don't hesitate to return for more reliable answers to any questions you may have. Your questions are important to us at Westonci.ca. Visit again for expert answers and reliable information.

Red green and blue light rays each enter a drop of water from the same direction which light ray's path through the drop will bend the most and which will bend

A proposed law is called a

thorium 234 has a half life of 24 days. If you started with a 100-g sample of thorium-234, how much would remain after 48 days?

Which event is the most common at oceanic-continental convergent boundaries? A. volcanic mountain ranges B. earthquakes C. faults D. rift valleys

One concern that arises from building a dam is that fish are not able to migrate. One way that fish can gain passage to their destinations is by: Select one: a.

Pepsin, a common enzyme found in the stomach, is most active at pH values between 0.5 and 2.5. It works slowly between pH values of 2.6 and 3.4. Beyond a pH of

A drawer has some red, green, and blue marbles. There are 33 marbles in all. Thete are 4 times as many red marbles as green marbles. There are half as many blu

Which statement is true? Lipids are a type of fat. Fats are a type of lipid. Fats and lipids are separate and unrelated substances. All lipids are fats, and all

Muddy water contains microorganisms, clay, and silt. Which of the following statements suggests that muddy water is a suspension? A.It is a heterogenous mixture

Sagot :

Other Questions