Answered

Discover the answers to your questions at Westonci.ca, where experts share their knowledge and insights with you. Experience the ease of finding reliable answers to your questions from a vast community of knowledgeable experts. Join our platform to connect with experts ready to provide precise answers to your questions in different areas.

DIRECTIONS: The following series of letters represent a coded message in a DNA molecule. Match the correct bases to transcribe the message just as DNA does. Next, break the code into codons, being very careful not to lose count or your place. Each codon of your RNA represents a word. Finally, record the words into the written message. Good luck! Double-check to make sure each codon has 3 bases, and that you did not make any errors.

DNA sequence:
TTAAAAGAACAATAAAATGATCATTAT
ATAGTACTATACATTGTTCTTTGCATGGTGCTG
TGGAGGGGCCGCTGTAGCGGGCGGTCTCTAACC
GGAGTTCTTTGCCGTTGCTCAACGGCTGTTCCA
CCATCGACAGCGCCTTGTCCCCCG

The end!

*Aren't you glad this coded DNA is only 150 base pairs long? In our cells, they are often thousands of times longer!

Sagot :

GinnyAnswer

Final answer:

Codons in mRNA represent amino acids, and the genetic code is degenerate, allowing multiple codons to specify the same amino acid.


Explanation:

Codons are sets of three bases in mRNA that represent specific amino acids. Each codon codes for a single amino acid, and the sequence of codons determines the sequence of amino acids in a protein. The genetic code is degenerate, meaning one amino acid can be encoded by multiple nucleotide triplets.


Learn more about DNA Codons and Genetic Code here:

https://brainly.com/question/39158302


Thanks for using our service. We aim to provide the most accurate answers for all your queries. Visit us again for more insights. We hope you found this helpful. Feel free to come back anytime for more accurate answers and updated information. Thank you for using Westonci.ca. Come back for more in-depth answers to all your queries.